View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6389_low_12 (Length: 256)
Name: NF6389_low_12
Description: NF6389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6389_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 18 - 97
Target Start/End: Original strand, 25609893 - 25609972
Alignment:
| Q |
18 |
gaaaatcagtgtgaatgcaaaattcaaatgttaagattagataatggaagtgattacacctcagaaaaattcaataagct |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
25609893 |
gaaaatcagtgtgaatgcaaaattcaaatgttaagattagataatggaagtgaatacacctcagaaaaattcaataagct |
25609972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University