View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6389_low_12 (Length: 256)

Name: NF6389_low_12
Description: NF6389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6389_low_12
NF6389_low_12
[»] chr5 (1 HSPs)
chr5 (18-97)||(25609893-25609972)


Alignment Details
Target: chr5 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 18 - 97
Target Start/End: Original strand, 25609893 - 25609972
Alignment:
18 gaaaatcagtgtgaatgcaaaattcaaatgttaagattagataatggaagtgattacacctcagaaaaattcaataagct 97  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
25609893 gaaaatcagtgtgaatgcaaaattcaaatgttaagattagataatggaagtgaatacacctcagaaaaattcaataagct 25609972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University