View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6390_high_19 (Length: 221)

Name: NF6390_high_19
Description: NF6390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6390_high_19
NF6390_high_19
[»] chr8 (2 HSPs)
chr8 (36-138)||(10344031-10344133)
chr8 (145-175)||(10344186-10344216)


Alignment Details
Target: chr8 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 36 - 138
Target Start/End: Original strand, 10344031 - 10344133
Alignment:
36 ttgacttaaaagttattttaagaaaacaaaaatagtttagtttataattttggtaatgtaaataaaaagcatgttaaaagaagaagtttctagaatggaa 135  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10344031 ttgacttaaaagttattttaagaaaacaaaaatagtttagtttataattttggtaatgtaaataaaaagcatgttaaaagaagaagtttctagaatggaa 10344130  T
136 ttg 138  Q
    |||    
10344131 ttg 10344133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 145 - 175
Target Start/End: Original strand, 10344186 - 10344216
Alignment:
145 tcacaaatcagttacataattcaaaataaaa 175  Q
    |||||||||||||||||||||||||||||||    
10344186 tcacaaatcagttacataattcaaaataaaa 10344216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University