View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6390_low_12 (Length: 249)
Name: NF6390_low_12
Description: NF6390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6390_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 8 - 156
Target Start/End: Original strand, 47493936 - 47494082
Alignment:
| Q |
8 |
agaagaagaagaagaatattactcctagaaagcaaagnnnnnnnntgaaaactagtgagtggagtagtagtaattagcaaaacccaaggagagtgtctcc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47493936 |
agaagaagaagaagaatattactcctagaaagcaaagaaaaaa--tgaaaactagtgagtggagtagtagtaattagcaaaacccaaggagagtgtctcc |
47494033 |
T |
 |
| Q |
108 |
cattgcacattcaaggcagggccctctttggcgccggtgtccccgcggg |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47494034 |
cattgcacattcaaggcagggccctctttggcgccggtgtccccgcggg |
47494082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University