View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6390_low_17 (Length: 239)
Name: NF6390_low_17
Description: NF6390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6390_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 9174712 - 9174928
Alignment:
| Q |
1 |
caattaatataacattagtctacnnnnnnnntattgtgaatatggatcaggtatgaaaggagcaaaccggaggtatgaataaattacagaagtaacgtca |
100 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
9174712 |
caatcaatataacattagtctacaaaaaaaatattgtgaatatggatcctgtatgaaaggagcaaaccggaggtatgtataaattacataagtaacgtca |
9174811 |
T |
 |
| Q |
101 |
aattcaacatggcatgtcatatatatttcagtttcattgtctccaaatatgtgtcggtgtttgaaaaagatgtaggcaccaagggagcttcataacaaaa |
200 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
9174812 |
aattcaacatggtatgtcatat--atttcagtttcattgtctccaaatatgtgtcggtgtttgaaaaagatgtaggctccaagggagctacataacaaaa |
9174909 |
T |
 |
| Q |
201 |
ttacaataaatattagcat |
219 |
Q |
| |
|
|||||| |||||||||||| |
|
|
| T |
9174910 |
ttacaacaaatattagcat |
9174928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University