View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6390_low_20 (Length: 221)
Name: NF6390_low_20
Description: NF6390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6390_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 36 - 138
Target Start/End: Original strand, 10344031 - 10344133
Alignment:
| Q |
36 |
ttgacttaaaagttattttaagaaaacaaaaatagtttagtttataattttggtaatgtaaataaaaagcatgttaaaagaagaagtttctagaatggaa |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10344031 |
ttgacttaaaagttattttaagaaaacaaaaatagtttagtttataattttggtaatgtaaataaaaagcatgttaaaagaagaagtttctagaatggaa |
10344130 |
T |
 |
| Q |
136 |
ttg |
138 |
Q |
| |
|
||| |
|
|
| T |
10344131 |
ttg |
10344133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 145 - 175
Target Start/End: Original strand, 10344186 - 10344216
Alignment:
| Q |
145 |
tcacaaatcagttacataattcaaaataaaa |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
10344186 |
tcacaaatcagttacataattcaaaataaaa |
10344216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University