View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6390_low_21 (Length: 219)
Name: NF6390_low_21
Description: NF6390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6390_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 19 - 204
Target Start/End: Complemental strand, 35796581 - 35796398
Alignment:
| Q |
19 |
gaagaacactcgtaaaccttaacaaaataaataaatttgaagtttgaaattttttacatttcccttgcttttatatgaagaggaatgtaatgatataatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35796581 |
gaagaacactcgtaaaccttaacaaaataaataaatttgaagtttgaaattttttacatttcccttgc--ttatatgaagaggaatgtaatgatataatt |
35796484 |
T |
 |
| Q |
119 |
aaagggtaaacaagagcttcttnnnnnnngggcaaacaagagtttttaaaaagatattaatttgtatccaattaccgcttaatttt |
204 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
35796483 |
aaagggtaaacaagagcttcttaaaaaaagggcaaacaagagtttttaaaaagatattaatttgtattcaattaccgcgtaatttt |
35796398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University