View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6390_low_5 (Length: 354)
Name: NF6390_low_5
Description: NF6390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6390_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 13 - 342
Target Start/End: Original strand, 38791957 - 38792286
Alignment:
| Q |
13 |
cgctaactcccgaacatagggttgcggtagtttggattagaatactcaagctacctatggaacccgccttttctttcgaggataggatcaactttttggg |
112 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38791957 |
cgctaaccgccgaacatagggttgcggtagtttggattagaatactcaagctacctatggaacccgccttttctttcgaggataggatcaactttttggg |
38792056 |
T |
|
| Q |
113 |
ggtgatgttgaaggttgatgataggctaagtgggaaatacgcgagaatatgtgtggagatagatttggatagacgtttgttgttgaatattatgcttttg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38792057 |
ggtgatgttgaaggttgatgataggctaagtgggaaatacgcgagaatatgtgtggagatagatttggatagacgtttgttgttgaatattatgcttttg |
38792156 |
T |
|
| Q |
213 |
ctgtggtcgatatggacacaagaaaggtaactgtgttgaaagagttagtgatgtttgagagaaaatgcaggggaagattgaagagattgtcgaggattta |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38792157 |
ctgtggtcgatatggacacaagaaaggtaactgtgttgaaagagttagtgatgtttgagagaaaatgcaggggaagattgaagagattgtcgaggattta |
38792256 |
T |
|
| Q |
313 |
gtcgcgaaggaagtagagctatgtttgatg |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38792257 |
gtcgcgaaggaagtagagctatgtttgatg |
38792286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University