View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6391_low_10 (Length: 203)
Name: NF6391_low_10
Description: NF6391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6391_low_10 |
 |  |
|
| [»] scaffold0009 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 17 - 150
Target Start/End: Complemental strand, 36700262 - 36700130
Alignment:
| Q |
17 |
aaaaacaactgttgttgattacttaggtgagaaaacata--attcacattctcttttctcaaattaatatcggtattgatgtgtagtgtccggtgtctgg |
114 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
36700262 |
aaaaacaactgttgtt---tacataggtgagaaaacatataattcacattctcttttctcaaattaatatcggtattgatgtgtagtgtccagtgtccgg |
36700166 |
T |
 |
| Q |
115 |
acttcatagatttatttgattgacatttcatttcac |
150 |
Q |
| |
|
|||| |||||||||||||| | |||||||||||||| |
|
|
| T |
36700165 |
acttgatagatttatttgactcacatttcatttcac |
36700130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 60; Significance: 8e-26; HSPs: 2)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 60; E-Value: 8e-26
Query Start/End: Original strand, 80 - 184
Target Start/End: Complemental strand, 145870 - 145770
Alignment:
| Q |
80 |
aatatcggtattgatgtgtagtgtccggtgtctggacttcatagatttatttgattgacatttcatttcactatttatatatgcagctatacatctaggg |
179 |
Q |
| |
|
|||||||||||| ||| |||||||| ||||| | ||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
145870 |
aatatcggtattaatgagtagtgtctagtgtccgaacttcatagatttatttgactgacatttcatttcactatt----tatgcagctatacatctaggg |
145775 |
T |
 |
| Q |
180 |
ctacc |
184 |
Q |
| |
|
||||| |
|
|
| T |
145774 |
ctacc |
145770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #2
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 23 - 89
Target Start/End: Complemental strand, 146211 - 146145
Alignment:
| Q |
23 |
aactgttgttgattacttaggtgagaaaacataattcacattctcttttctcaaattaatatcggta |
89 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
146211 |
aactgtggttgattacttaggtgagaaaacacaattcatattctcttttctcaaattaatatcggta |
146145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University