View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6391_low_8 (Length: 233)
Name: NF6391_low_8
Description: NF6391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6391_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 18 - 225
Target Start/End: Complemental strand, 32187815 - 32187608
Alignment:
| Q |
18 |
actagatgttaaggatctttgatgtggaattattttatcatcataagatctcacaaaccaaatgattttgagggagtactgttaaatgagccatagaagt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32187815 |
actagatgttaaggatctttgatgtggaattattttatcatcataagatctcacaaaccaaatgattttgagggagtactgttaaatgagccatagaagt |
32187716 |
T |
 |
| Q |
118 |
gtgtctcgggttgagaaagaaaggtatatgaaagtaggggcaaatttgaattgtccattcacccatgtggtgacatataattatagttaatcctcgtaac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
32187715 |
gtgtctcgggttgagaaagaaaggtatatgaaagtaggggcaaatttgaattgtccatccacccatgtggtgacatataactatggttaatcctcgtaac |
32187616 |
T |
 |
| Q |
218 |
tgatgatg |
225 |
Q |
| |
|
|||||||| |
|
|
| T |
32187615 |
tgatgatg |
32187608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University