View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6392_high_103 (Length: 205)

Name: NF6392_high_103
Description: NF6392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6392_high_103
NF6392_high_103
[»] chr5 (1 HSPs)
chr5 (18-193)||(39396353-39396529)


Alignment Details
Target: chr5 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 18 - 193
Target Start/End: Complemental strand, 39396529 - 39396353
Alignment:
18 gtaggctgtgtaatggatgttgtgatgtgttggcaggttt-agtgtgctgactgtaggctgtgtaatgggtggttttttgtgcagcacatttggtgttta 116  Q
    ||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39396529 gtaggctgtgttatggatgttgtgatgtgttggcaggtttgagtgtgctgactgtaggctgtgtaatgggtggttttttgtgcagcacatttggtgttta 39396430  T
117 ttgtgtatgtatgagaggttttctttgtatctttgtgggcgcannnnnnngcccactgtaggacatttgcctttgct 193  Q
    ||||||||||||||| |||||||||||||||||||||||||||       | |||||||| ||||||||| ||||||    
39396429 ttgtgtatgtatgaggggttttctttgtatctttgtgggcgcatttttttggccactgtaagacatttgcttttgct 39396353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University