View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6392_high_64 (Length: 283)
Name: NF6392_high_64
Description: NF6392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6392_high_64 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 273
Target Start/End: Complemental strand, 47180269 - 47180015
Alignment:
| Q |
18 |
agggatgacgagaggtttgcctttgatcattgatacaaataaatacaataaaatgctcaatgattcaatgcatctcatcaagttttaagggaaccaaata |
117 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47180269 |
agggatgacgagaggtttgcttttgatcattgatacaaataaatacaataaaatgctcaatgattcaatgcatctcatcaagttttaagggaaccaaata |
47180170 |
T |
 |
| Q |
118 |
gctagaacctagaagaataaatttggcgttttttgaatannnnnnnnaggagaaatagaagctaggtaagctcacagagatgaggttttcagggtgaatg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47180169 |
gctagaacctagaagaataaatttggcgttttttgaata-tttttttaggagaaatagaagctaggtaagctcacagagatgaggttttcagggtgaatg |
47180071 |
T |
 |
| Q |
218 |
actgaagtcatcacagtttcttttcatcttttgctggctgaattgactaccctatg |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47180070 |
actgaagtcatcacagtttcttttcatcttttgctggctgaattgactaccctatg |
47180015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University