View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6392_high_66 (Length: 279)
Name: NF6392_high_66
Description: NF6392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6392_high_66 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 15 - 262
Target Start/End: Original strand, 7432496 - 7432744
Alignment:
| Q |
15 |
gagatgaataaaatgaaacagggttattatggttgatgagttgtgagaaatgtgtatatgggacgggtaccctcccatatattggatggatc-attggac |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7432496 |
gagatgaataaaatgaaacagggttattatggttgatgagttttgagaaatgtgtatatgggacgggtaccctcccatatattggatggatcaattggac |
7432595 |
T |
 |
| Q |
114 |
cggttggacatgattttgagtttcgtgactttatctctatcnnnnnnnnaatcaatcattcgtttatcaattaaatatactaaagtcactaaaacttaaa |
213 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7432596 |
cggttggacatgattttgagtttcttgactttatctctatcttttttttaatcaatcattcgtttatcaattaaatatactaacgtcactaaaacttaaa |
7432695 |
T |
 |
| Q |
214 |
tcatcaagtattttcccaattctctatcttaagttatacacatactctt |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7432696 |
tcatcaagtattttcccaattctctatctttagttatacacatactctt |
7432744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University