View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6392_high_75 (Length: 257)

Name: NF6392_high_75
Description: NF6392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6392_high_75
NF6392_high_75
[»] chr1 (3 HSPs)
chr1 (1-238)||(31127645-31127882)
chr1 (1-232)||(31078327-31078558)
chr1 (1-229)||(31132353-31132584)
[»] chr7 (2 HSPs)
chr7 (85-176)||(38642947-38643038)
chr7 (85-176)||(38655855-38655946)


Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 31127645 - 31127882
Alignment:
1 atatggggacccgattgggctgagtttcgacctgagagatggttgagccaagttgatgatggaaagtggagctttattgggatggatccttatagttatg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
31127645 atatggggacccgattgggctgagtttcgacctgagagatggttgagtcaagttgatgatggaaagtggagctttattgggatggatccttatagttatg 31127744  T
101 cggtttttcaggctgggccaagggtgtgtttgggaaaggaaatggcgttcttgcagatgaaaagggtggttgctgggatcatgaggcagtttagggtggt 200  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
31127745 cggtttttcaggctgggccaagggtgtgtttaggaaaggaaatggcgttcttgcagatgaaaagggtggttgccgggatcatgaggcagtttagggtggt 31127844  T
201 tcctgcaatggataaaggggttgagccagagttcgctg 238  Q
    ||||||||||||||||||||||||||| ||||||||||    
31127845 tcctgcaatggataaaggggttgagccggagttcgctg 31127882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 31078327 - 31078558
Alignment:
1 atatggggacccgattgggctgagtttcgacctgagagatggttgagccaagttgatgatggaaagtggagctttattgggatggatccttatagttatg 100  Q
    ||||||||||  |||||||||||||||||||| ||||| |||||||| |||| ||| ||||| |||||||| ||||||||||||||||||||||||||||    
31078327 atatggggacttgattgggctgagtttcgaccggagaggtggttgagtcaagatgaggatgggaagtggagttttattgggatggatccttatagttatg 31078426  T
101 cggtttttcaggctgggccaagggtgtgtttgggaaaggaaatggcgttcttgcagatgaaaagggtggttgctgggatcatgaggcagtttagggtggt 200  Q
    |||||||||| |||||||| ||||||||||| ||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||    
31078427 cggtttttcaagctgggccgagggtgtgtttaggaaaggaaatggcgttcttgcagatgaagagggtggttgcagggatcatgaggcagtttagggtggt 31078526  T
201 tcctgcaatggataaaggggttgagccagagt 232  Q
    ||||||||||||||||||||||||||| ||||    
31078527 tcctgcaatggataaaggggttgagccggagt 31078558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 31132353 - 31132584
Alignment:
1 atatggggacccgattgggctgagtttcgacctgagagatggttgagccaagttgatgatggaaagtggagctttattgggatggatccttatagttatg 100  Q
    ||||||||| ||||||||||||||||| |||||||||| |||||||| | || ||| |||||||| ||||||||| |||||||||||||||||| ||||     
31132353 atatggggatccgattgggctgagttttgacctgagaggtggttgagtcgagctgacgatggaaaatggagctttgttgggatggatccttatacttatc 31132452  T
101 cggtttttcaggctgggccaagggtgtgtttgggaaaggaaatggcgttcttgcagatgaa---aagggtggttgctgggatcatgaggcagtttagggt 197  Q
    || ||||||| |||||||| ||||||||||| || || ||||||||||||||  | |||||    ||| |||||| ||| || || ||| |||||||| |    
31132453 cgatttttcaagctgggccgagggtgtgtttagggaaagaaatggcgttcttagaaatgaagatcaggttggttgttggcattataagggagtttaggtt 31132552  T
198 ggttcctgcaatggataaaggggttgagccag 229  Q
    | |||| || |||||| |||||||||| ||||    
31132553 gcttccagcgatggatgaaggggttgaaccag 31132584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 85 - 176
Target Start/End: Original strand, 38642947 - 38643038
Alignment:
85 gatccttatagttatgcggtttttcaggctgggccaagggtgtgtttgggaaaggaaatggcgttcttgcagatgaaaagggtggttgctgg 176  Q
    ||||||| || |||| ||||||||||||||||||| ||| | |||||||| || |||||||| ||  |||| ||||||||| | ||||||||    
38642947 gatccttttacttatccggtttttcaggctgggccgaggatttgtttggggaaagaaatggcatttatgcaaatgaaaaggattgttgctgg 38643038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 85 - 176
Target Start/End: Original strand, 38655855 - 38655946
Alignment:
85 gatccttatagttatgcggtttttcaggctgggccaagggtgtgtttgggaaaggaaatggcgttcttgcagatgaaaagggtggttgctgg 176  Q
    ||||||| || |||| ||||||||||||||||||| ||| | |||||||| || |||||||| ||  |||| ||||||||| | ||||||||    
38655855 gatccttttacttatccggtttttcaggctgggccgaggatttgtttggggaaagaaatggcatttatgcaaatgaaaaggattgttgctgg 38655946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University