View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6392_high_81 (Length: 245)
Name: NF6392_high_81
Description: NF6392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6392_high_81 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 18 - 100
Target Start/End: Original strand, 411166 - 411248
Alignment:
| Q |
18 |
tttgagtaatttgaaatgacagtatgcttagaatatctattgaaatgtgtatgaatctattgttagaaagaattttcatgaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
411166 |
tttgagtaatttgaaatgacagtatgcttagaatatctattgaaatgtgtatgaatctattgttagaaagaattttcatgaaa |
411248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 168 - 235
Target Start/End: Original strand, 411251 - 411318
Alignment:
| Q |
168 |
tgtatagtgttcttcaatagaagtcaaccgaactaaacgaagcattgattgatccaaccctgatgatg |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
411251 |
tgtatagtgttcttcaatagaagtcaaccgaactaaacgaagcattgattgatccaaccctgatgatg |
411318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University