View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6392_high_81 (Length: 245)

Name: NF6392_high_81
Description: NF6392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6392_high_81
NF6392_high_81
[»] chr2 (2 HSPs)
chr2 (18-100)||(411166-411248)
chr2 (168-235)||(411251-411318)


Alignment Details
Target: chr2 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 18 - 100
Target Start/End: Original strand, 411166 - 411248
Alignment:
18 tttgagtaatttgaaatgacagtatgcttagaatatctattgaaatgtgtatgaatctattgttagaaagaattttcatgaaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
411166 tttgagtaatttgaaatgacagtatgcttagaatatctattgaaatgtgtatgaatctattgttagaaagaattttcatgaaa 411248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 168 - 235
Target Start/End: Original strand, 411251 - 411318
Alignment:
168 tgtatagtgttcttcaatagaagtcaaccgaactaaacgaagcattgattgatccaaccctgatgatg 235  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
411251 tgtatagtgttcttcaatagaagtcaaccgaactaaacgaagcattgattgatccaaccctgatgatg 411318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University