View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6392_high_92 (Length: 238)
Name: NF6392_high_92
Description: NF6392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6392_high_92 |
 | |
|
| [»] scaffold0066 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 13 - 221
Target Start/End: Original strand, 7425913 - 7426121
Alignment:
| Q |
13 |
agcagagacatctcattttgaatgcagatatagcaaggcgctgacagcaatattggtggtattgcaacagtataattcattaattgagaaaatatttttt |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7425913 |
agcagggacatctcattttgaatgcagatatagcaaggcgctgacagcaatattggtggtattgcaacagtataattcattaattgagaaaatatttttt |
7426012 |
T |
|
| Q |
113 |
ctttctcagggcatattaagatgttattctattctcttaaatggcagcagcatttgcaagttgttttcaaaattatgcgttaaattttcaacaattgcaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7426013 |
ctttctcagggcatattaagatgttattctattctcttaaatggcagcagcatttgcaagttgttttcaaaattatgcgttaaatttttaacaattgcaa |
7426112 |
T |
|
| Q |
213 |
tcttggcaa |
221 |
Q |
| |
|
||||||||| |
|
|
| T |
7426113 |
tcttggcaa |
7426121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0066 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: scaffold0066
Description:
Target: scaffold0066; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 21 - 215
Target Start/End: Complemental strand, 17793 - 17602
Alignment:
| Q |
21 |
catctcattttgaatgcagatatagcaaggcgctgacagcaatattggtggtattgcaacagtataattcattaattgagaaaatattttttctttctca |
120 |
Q |
| |
|
||||||| ||||| |||| ||||||||||| |||| |||||| ||||||||||| ||||||| ||||| ||||||||||||| | ||||||| ||| |
|
|
| T |
17793 |
catctcagtttgattgcatatatagcaaggtgctggcagcaacattggtggtatcctaacagtagaattccttaattgagaaaaga---tttctttgtca |
17697 |
T |
|
| Q |
121 |
gggcatattaagatgttattctattctcttaaatggcagcagcatttgcaagttgttttcaaaattatgcgttaaattttcaacaattgcaatct |
215 |
Q |
| |
|
||||| || || |||| ||||||||||||||||||||||||| | | |||||||||| |||||| ||||||||||| || |||||||||| |
|
|
| T |
17696 |
gggcaggttgagttgttcagctattctcttaaatggcagcagcatctttatgttgttttcatcattatgtgttaaattttcgactattgcaatct |
17602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University