View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6392_high_99 (Length: 217)
Name: NF6392_high_99
Description: NF6392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6392_high_99 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 42037954 - 42038170
Alignment:
| Q |
1 |
aacaacaaatgaagaaaagaaacgaataaacgacaaaatcatcagcgacaaaacatcccaaaaacctgagaataacctccaaaaccagactactcgtcgg |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
42037954 |
aacaacaaatgaagaaaagaaatgaataaacgacaaaatcatcaacgacaaaacatcccaaaaacctgagaataacctacaaaaccagactacccgtcgg |
42038053 |
T |
 |
| Q |
101 |
aagttgcccattccctaggggaacagggagagggaccaaacctaatgggctgtcgagaattggaagacaaaccacccaagcccgctgagaccccaacaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42038054 |
aagttgcccattccctaggggaacagggagagggaccaaacctaatgggctgtcgaggattggaagacaaaccacccaagcccgctgagaccccaacaca |
42038153 |
T |
 |
| Q |
201 |
gacactcacacaagatt |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
42038154 |
gacactcacacaagatt |
42038170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University