View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6392_low_101 (Length: 228)
Name: NF6392_low_101
Description: NF6392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6392_low_101 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 35796054 - 35796281
Alignment:
| Q |
1 |
agagagtacttagttccactatacctcataatgggtagaaattttaggaaaagtagataggatgagagaagagcaccctacctggcaacaactttaatta |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35796054 |
agagagtacttggttccactatacctcataatgggtagaaattttaggaaaagtagataggatgagagaagagcaccctacctggcaacaactttaatta |
35796153 |
T |
 |
| Q |
101 |
tatctctctagctccctttttgaatttggttggctgaagatgctgtatgacgttttgtcatggattttaggtatagcttctagaccatattcatgcatgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35796154 |
tatctctctagctccctttttgaatttggttggctgaagatgctgtatgacgttttgtcatggattttaggtatagcttctagaccatattcatgcatgt |
35796253 |
T |
 |
| Q |
201 |
ttacattactgatcagtggaaatataac |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
35796254 |
ttacattactgatcagtggaaatataac |
35796281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University