View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6392_low_106 (Length: 206)
Name: NF6392_low_106
Description: NF6392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6392_low_106 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 30274551 - 30274355
Alignment:
| Q |
1 |
ctgatcctttacttcttctcactgtcatgaaatcaacctttaactcagctggacttgaccctttcaagtaaatgcaaacaatgatttctaaatacaaa-a |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30274551 |
ctgatcctttacttcttctcactgtcatgaaatcaacctttaactcagctggacttgaccctttcaagtaaatgcaaacaatgatttctaaattcaaatt |
30274452 |
T |
 |
| Q |
100 |
ttcgttattattcttcgttctgttaaatgttaacattttgatcacaatctctaagcatcctttacatgactactttcagagatgcagatagtgatgat |
197 |
Q |
| |
|
||| || |||||||| ||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30274451 |
ttcttttttattcttagttctgttaaatgttaaca-tttgatcacaatctcaaagcatcctttacatgactactttcagagatgcagatagtgatgat |
30274355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 131 - 170
Target Start/End: Complemental strand, 31139891 - 31139852
Alignment:
| Q |
131 |
aacattttgatcacaatctctaagcatcctttacatgact |
170 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31139891 |
aacaatttgatcacaatctcaaagcatcctttacatgact |
31139852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 21 - 56
Target Start/End: Original strand, 46270708 - 46270743
Alignment:
| Q |
21 |
actgtcatgaaatcaacctttaactcagctggactt |
56 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
46270708 |
actgtcatgaaatcaacttttaactcagctggactt |
46270743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University