View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6392_low_107 (Length: 205)
Name: NF6392_low_107
Description: NF6392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6392_low_107 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 18 - 193
Target Start/End: Complemental strand, 39396529 - 39396353
Alignment:
| Q |
18 |
gtaggctgtgtaatggatgttgtgatgtgttggcaggttt-agtgtgctgactgtaggctgtgtaatgggtggttttttgtgcagcacatttggtgttta |
116 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39396529 |
gtaggctgtgttatggatgttgtgatgtgttggcaggtttgagtgtgctgactgtaggctgtgtaatgggtggttttttgtgcagcacatttggtgttta |
39396430 |
T |
 |
| Q |
117 |
ttgtgtatgtatgagaggttttctttgtatctttgtgggcgcannnnnnngcccactgtaggacatttgcctttgct |
193 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| | |||||||| ||||||||| |||||| |
|
|
| T |
39396429 |
ttgtgtatgtatgaggggttttctttgtatctttgtgggcgcatttttttggccactgtaagacatttgcttttgct |
39396353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University