View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6392_low_16 (Length: 467)
Name: NF6392_low_16
Description: NF6392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6392_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 351; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 351; E-Value: 0
Query Start/End: Original strand, 1 - 379
Target Start/End: Complemental strand, 45341322 - 45340949
Alignment:
| Q |
1 |
acattaaaataaatcccaacaatgacaacatagtagagcctgattgtggagggatacaattatattgtaagaggagaatgatagaccttgggggtacatc |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45341322 |
acattaaaataaatcccaacaatga-----tagtagagcctgattgtggagggatacaattatattgtaagaggagaatgatagaccttgggggtacatc |
45341228 |
T |
 |
| Q |
101 |
aatgggaaatttctatgtggatcgggagtagccctccaataccgggagctttcatgcacatgtataccaccataattgtcatgtatacatgtctcaggct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | |
|
|
| T |
45341227 |
aatgggaaatttctatgtggatcgggagtagccctccaataccgggagctttcatgcacatgtataccaccataattgtcatgtatacatatctcaggtt |
45341128 |
T |
 |
| Q |
201 |
gagttgaggagatctacgagaacatagagttgttcattcacattaacctcccaaccaagtacttcagagtagaatgaaacaaaatcatggagtatagtgt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45341127 |
gagttgaggagatctacgagaacatagagttgttcattcacattaacctcccaaccaagtacttcagagtagaatgaaacaaaatcatggagtatagtgt |
45341028 |
T |
 |
| Q |
301 |
tgcattgtcttgtgattgttgttgtgatcaatgtgtagcaaaaggtgactatgatttcttttgaataacttgatgtctt |
379 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45341027 |
tgcattgtcttgtgattgttgttgtgatcaatgtgtagcaaaaggtgactatgatttcttttgaataacttgatgtctt |
45340949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University