View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6392_low_32 (Length: 396)
Name: NF6392_low_32
Description: NF6392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6392_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 2 - 227
Target Start/End: Complemental strand, 32777040 - 32776815
Alignment:
| Q |
2 |
catcatttcatttcatattgtcaagttaattaatagtgtatatctttcttttgtttgcaagtatatacatcaaatgttcacttttccaagtgtgagttgg |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32777040 |
catcatttcatttcatattgtcaagttaattaatagtgtatatctttctgttgtttgcaagtatatacatcaaatgttcacttttccaagtgtgagttgg |
32776941 |
T |
|
| Q |
102 |
ggttttagaagtttaatatattaccttcctttatatttttatatgaaaaaatatttgtgtgcgctgataactcatttaaaactgtaagagggatataaat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32776940 |
ggttttagaagtttaatatattaccttcctttatatttttatatgaaaaaatatttgtgtgcgctgataactcatttaaaactgtaagagggatataaat |
32776841 |
T |
|
| Q |
202 |
aaagaggggaatcgcccctctcgtgt |
227 |
Q |
| |
|
||||||||||||| |||||||||||| |
|
|
| T |
32776840 |
aaagaggggaatcacccctctcgtgt |
32776815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 344 - 382
Target Start/End: Complemental strand, 32776689 - 32776651
Alignment:
| Q |
344 |
tgagagaatctctttccgttgaatgagagtttgagaatt |
382 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
32776689 |
tgagagaatctcttcccgttgaatgacagtttgagaatt |
32776651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University