View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6392_low_42 (Length: 366)
Name: NF6392_low_42
Description: NF6392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6392_low_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 52; Significance: 9e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 234 - 297
Target Start/End: Complemental strand, 12574467 - 12574404
Alignment:
| Q |
234 |
aacaaagttaagcatatctagcaagattcgagatggaatatcaacaatttaaatctctatacat |
297 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
12574467 |
aacaaatttaagcatatctagcaagattcgagatggaaaatgaacaatttaaatctctatacat |
12574404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 49; Significance: 6e-19; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 234 - 294
Target Start/End: Complemental strand, 501044 - 500984
Alignment:
| Q |
234 |
aacaaagttaagcatatctagcaagattcgagatggaatatcaacaatttaaatctctata |
294 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
501044 |
aacaaagttaagcatatctagcaatattcgagatggaaaatcaacgatttaaatctctata |
500984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 44
Target Start/End: Original strand, 500264 - 500300
Alignment:
| Q |
8 |
tagggtttggtgcttgttcaaaaaacaatagggtttg |
44 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
500264 |
tagggtttggtgcttgtttaaaaaagaatagggtttg |
500300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University