View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6392_low_45 (Length: 358)
Name: NF6392_low_45
Description: NF6392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6392_low_45 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 1 - 340
Target Start/End: Complemental strand, 55383476 - 55383137
Alignment:
| Q |
1 |
taatgttaacttgtggagcaaaatggatgtcagcctctccaattccatccaaatgctcactgcnnnnnnnnnnnnnnnnnnnnnncaccaataactatcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
55383476 |
taatgttaacttgtggagcaaaatggatgtcagcctctccaattccatccaaatgctcacggccttcttcttcttcatcttcttccaccaataactatcg |
55383377 |
T |
|
| Q |
101 |
acccgccgtcattctcccggttagtctctctttctctttctctatatctatattatcaccgctcctcacatcgcattcatttggttttttatttcttgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55383376 |
acccgccgtcattctcccggttagtctctctttctctttctctatatctatattatcaccgctcctcacatcgcattcatttggttttttatttcttgaa |
55383277 |
T |
|
| Q |
201 |
ccaggggttagggaacaattccggtgactaccagaagttggaggcaactctgaacaataactacggtgtgtccaccgttgttgccaaggtgtcaagacct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55383276 |
ccaggggttagggaacaattccggtgactaccagaagttggaggcaactctgaacaataactacggtgtgtccaccgttgttgccaaggtgtcaagacct |
55383177 |
T |
|
| Q |
301 |
gattggctccggaatgccgctggtttgatcgatcccaatt |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55383176 |
gattggctccggaatgccgctggtttgatcgatcccaatt |
55383137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University