View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6392_low_46 (Length: 358)
Name: NF6392_low_46
Description: NF6392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6392_low_46 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 310; Significance: 1e-174; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 10 - 339
Target Start/End: Complemental strand, 12065491 - 12065162
Alignment:
| Q |
10 |
agtgagatgaatataagagaaagagcgctgctactaacccaatttcataaaagataaactttataacatgagaaagagagagtcatatatatttaattat |
109 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12065491 |
agtgaaatgaatataagagaaagagcactgctactaacccaatttcataaaagataaactttataacatgagaaagagagagtcatatatatttaattat |
12065392 |
T |
|
| Q |
110 |
gaaaaagtatgaaacacaaggttgttatacatatcaagtttacgggctagtagaaagagagagcagttacattattcatttgccatagttgcaatgatca |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12065391 |
gaaaaagtatgaaacacaaggttgttatacatatcaagtttacgggctagtagaaagagagagtagttacattattcatttgccatagttgcaatgatca |
12065292 |
T |
|
| Q |
210 |
ctcacattatacttttgctgaaatatattttctggtcggcatgtattaaccttttttaagacatagagtgatggggctttttgactctagattgaagaat |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12065291 |
ctcacattatacttttgctgaaatatattttccggtcggcatgtattaaccttttttaagacatagagtgatggggctttttgactctagattgaagaat |
12065192 |
T |
|
| Q |
310 |
atctttgaaggattgcacaagaaatcctat |
339 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
12065191 |
ctctttgaaggattgcacaagaaatcctat |
12065162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 243
Target Start/End: Original strand, 12101799 - 12101862
Alignment:
| Q |
178 |
acattattcatttgccatagttgcaatgatcactcacattatacttttgctgaaatatattttctg |
243 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
12101799 |
acattattcacttgccatagtgtcaatgatcactcacat--tacttttgctgaaatattttttctg |
12101862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University