View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6392_low_74 (Length: 263)
Name: NF6392_low_74
Description: NF6392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6392_low_74 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 6458188 - 6458439
Alignment:
| Q |
1 |
tggttactgacgctgtcacaaaagggcttcctcttacgaggaagaaccgcaggttagacaagggaatgtccaaagtgacaccgagatcactgaaggaaga |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6458188 |
tggttactgacactgtcacaaaagggcttcctcttacgaggaagaaccgcaggttagacaagggaatgtccaaagtgacaccgagatcactgaaggaaga |
6458287 |
T |
 |
| Q |
101 |
gatcacatgtttttcatgtgagtcttggtttgttttcatggaggtagaaatagtgatatcagggtcgaagacttgagctatgaaagaagcgttggaggtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6458288 |
gatcacatgtttttcatgtgagtcttggtttgttttcatggaggtagaaatagtgatatcagggtcgaagacttgagctatgaaagaagcgttggaggtg |
6458387 |
T |
 |
| Q |
201 |
caagtagggtagcagagggagagggaggagtttgaggagttgatgaggtaag |
252 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
6458388 |
caagtagggtagcagagggagagggagaagtttgaggatttgatgaggtaag |
6458439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University