View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6392_low_75 (Length: 262)
Name: NF6392_low_75
Description: NF6392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6392_low_75 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 11 - 262
Target Start/End: Complemental strand, 7666718 - 7666467
Alignment:
| Q |
11 |
catcatcattggctgagattcctcaacttgttgaattacatcttgnnnnnnntcagtttagtggtaatattccaaatttgaataatccttcattgatgat |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7666718 |
catcatcattggctgagattcctcaacttgttgaattacatcttgaaaaaaatcagtttagtggtaatattccaaatttgaataatccttcattgatgat |
7666619 |
T |
 |
| Q |
111 |
ttttgatgtttcaaataataatttggaaggtgaagttcctcaaggtttgttgagattcaatggaaattcttttttaggaaattctggtttatgtggcgaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7666618 |
ttttgatgtttcaaataataatttggaaggtgaagttcctcaaggtttgttgagattcaatggaaattcttttttaggaaattctggtttatgtggcgaa |
7666519 |
T |
 |
| Q |
211 |
aaaatcggcaaaatatgtggacaacaaccagtgcaacaaacaaatcctattc |
262 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7666518 |
aaaatgggcaaaatatgtggacaacaaccagtgcaacaaacaaatcctattc |
7666467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University