View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6392_low_78 (Length: 259)
Name: NF6392_low_78
Description: NF6392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6392_low_78 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 259
Target Start/End: Complemental strand, 2947778 - 2947537
Alignment:
| Q |
18 |
cttacttatgccatcaaattactctctgacaatcccttggtgttcaagcaattacaagtacgttacaaatatatatttttnnnnnnnntcagaatctttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2947778 |
cttacttatgccatcaaattactctctgacaatcccttggtgttcaagcaattacaagtacgttacaaatatatatttttaaaaaaaatcagaatctttt |
2947679 |
T |
 |
| Q |
118 |
gaactannnnnnnattgctttacgacgtcgattttgacttcctcggtactttgtcttttaggaagaacatgaagccatccttgaacgacgtgagaatcct |
217 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2947678 |
gaactatttttttattgctttacgacgtcgattttgacttcctcggtactttgtcttttaggaagaacatgaagccatccttgaacgacgtgagaatcct |
2947579 |
T |
 |
| Q |
218 |
aactcaggagtcacatggcaagaatataaatcaatgacattt |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2947578 |
aactcaggagtcacatggcaagaatataaatcaatgacattt |
2947537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University