View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6392_low_94 (Length: 239)
Name: NF6392_low_94
Description: NF6392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6392_low_94 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 17 - 239
Target Start/End: Original strand, 50253259 - 50253481
Alignment:
| Q |
17 |
attgttgacatcgaattttatcactccaacaaataagctcgacgatcaatctatgacaaaatttagatgccagttgaattcttagttgataggttcaaag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
50253259 |
attgttgacatcgaattttatcactccaacaaataagctcgacgatcaatctatgacaaaatttagatcctagttgaattcttagttgataggttcaaag |
50253358 |
T |
|
| Q |
117 |
tcacacgtcttaattttcgaaacaagaaacatgcatttgaattataaacaaagaaagtaaaaatgcagagaaaattcgatcatgcgtagtaaattagaaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
50253359 |
tcacacgtcttaattttcgaaacaagaaacatgcattcgaattataaacaaagaaagtaaaaatgcaaagaaaattcgatcatgcgtagtaaattagaaa |
50253458 |
T |
|
| Q |
217 |
gtagcgtttcgttccttctctct |
239 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
50253459 |
gtagtgtttcgttccttctctct |
50253481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University