View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6392_low_97 (Length: 238)
Name: NF6392_low_97
Description: NF6392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6392_low_97 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 2 - 223
Target Start/End: Complemental strand, 21114277 - 21114056
Alignment:
| Q |
2 |
tagaattcgagttcctaaatatgattttatcaaacttattaaaattgaggttccgatnnnnnnnnngaagtgttttgtctataactaaaattgcggttga |
101 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
21114277 |
tagaattcgagttcctaaatatgattttagcaaacgtattaaaattgaggttccgataaaaaaagaatagagttttgtctataactaaaattgcggttga |
21114178 |
T |
|
| Q |
102 |
aaactactttaactaatcacaacttgacatgtgattttgacaactctttaaaaatggttttataaaaatattcacactcttttacattgacattaattgc |
201 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21114177 |
aaactactttaactaatcacaacttaacatatgattttgacaactctttaaaaatggttttataaaaatattcacactcttttacattgacattaattgc |
21114078 |
T |
|
| Q |
202 |
aaacatttttgtacgaaatcat |
223 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
21114077 |
aaacatttttgtacgaaatcat |
21114056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University