View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6394_low_1 (Length: 258)
Name: NF6394_low_1
Description: NF6394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6394_low_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 14 - 248
Target Start/End: Original strand, 23782437 - 23782671
Alignment:
| Q |
14 |
agggacaattcttcaaatcactttgattcaatactcaagttacaattttattctctaagaattttaaaataattcttttaacgaaaataaatttcactaa |
113 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23782437 |
agggacatttcttcaaatcactttgattcaatactcaagttacaattttaatctctaagaattttaaaataattcttttaacgaaaataaatttcactaa |
23782536 |
T |
 |
| Q |
114 |
catgtgacaatttatttctctaattgaactaattgcaaacccgtgtatccgcacgggtctagagcattggtaaatcatattttagatgaagttataatga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
23782537 |
catgtgacaatttatttctctaattgaactaattgcaaacccgtgtatccgcacgggtctagagtattggtaaatcatattttagataaagttataatga |
23782636 |
T |
 |
| Q |
214 |
gttaaaattatcgcaactcttaataatatatccat |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
23782637 |
gttaaaattatcgcaactcttaataatatatccat |
23782671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University