View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6395_high_12 (Length: 269)
Name: NF6395_high_12
Description: NF6395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6395_high_12 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 12 - 269
Target Start/End: Original strand, 7831648 - 7831905
Alignment:
| Q |
12 |
agcacagagaaaggatgtacagaatgaagagatgtgtcaagagaaaccgagaggaactggagagagtttgttctggaaaggagtcgaagatgaagtctca |
111 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7831648 |
agcacagagaaaggatgtatagaatgaagagatgtgtcaagagaaaccgagaggaactggagagagtttgttctggaaaggagccgaagatgaagtctca |
7831747 |
T |
 |
| Q |
112 |
gctccaagacgtcgctattggggaagcgttgagttacaagatggagatccacttgtttggagaagctggaatgggaaagaaaccttttgggagagggtga |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7831748 |
gctccaagacgtcgctattggggaagcgttgagttacaagatggagatccacttgtttggagaagctggaatgggaaagaaaccttttgggagagggtga |
7831847 |
T |
 |
| Q |
212 |
gaaatattgttattctgttgaaatgccaaaattgttctgtagaggaagcttcaagctc |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7831848 |
gaaatattgttattctgttgaaatgccaaaattgttctgtagaggaagcttcaagctc |
7831905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University