View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6395_high_6 (Length: 454)
Name: NF6395_high_6
Description: NF6395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6395_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 406; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 406; E-Value: 0
Query Start/End: Original strand, 1 - 418
Target Start/End: Original strand, 55145558 - 55145975
Alignment:
| Q |
1 |
aatggttgcagcaaggagatatggaacagacatgacattgtggtatggactgaaagggagaggagatccttataggactcttttgagagaagggatcact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55145558 |
aatggttgcagcaaggagatatggaacagacatgacattgtggtatggactgaaagggagaggagatccttataggactcttttgagagaagggatcact |
55145657 |
T |
 |
| Q |
101 |
gcacttcttaactcatataacagcatccaattctcttaccatccacttggtgtaatcacacacatgaattatgctttgatgggctcaactagggatgtcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55145658 |
gcacttcttaactcatataacagcatccaattctcttaccatccacttggtgtaatcacacacatgaattatgctttgatgggctcaactagggatgtcc |
55145757 |
T |
 |
| Q |
201 |
tcgttactgcttatcacttcatgagagctaattctggtgctggaaatgtttcttgcaaattcacttcttgcaattaatattttacccttttcctagtatg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55145758 |
tcgttactgcttatcacttcatgagagctaattctggtgctggaaatgtttcttgcaaattcacttcttgcaattaatattttacccttttcctagtatg |
55145857 |
T |
 |
| Q |
301 |
ttcgggaaattatttattatttttaacaactttatctatcttatccagaaaaaatgttgacgcactgtaaacattcatgctatgctagaatgttaattta |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
55145858 |
ttcgggaaattatttattatttttaacaactttatctatcttatccagaaaaaatgttgacgcactgtaaacatatatgctatgctagaatgttaattta |
55145957 |
T |
 |
| Q |
401 |
aatatattctataaatgg |
418 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
55145958 |
aatatattctatatatgg |
55145975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University