View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6396_high_10 (Length: 240)
Name: NF6396_high_10
Description: NF6396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6396_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 37227268 - 37227110
Alignment:
| Q |
1 |
cggagttttaagatcccctgaatccgaacgagcaagactccggtaatgcattgaaaatgcagtcgagtccatcgtaatgtcgtcggagacaccggaatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37227268 |
cggagttttaagatcccctgaatccgaacgagcaagactccggtaatgcattgaaaatgcagtcgagtccatcgtaatgtcgtcggagacaccggaatct |
37227169 |
T |
|
| Q |
101 |
gataaacgttccggtttaatgaaatccgtcgatacaggaccacgaaattcgtcatctgc |
159 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37227168 |
gatagccgttccggtttaatgaaatccgtcgatacaggaccacgaaattcgtcatctgc |
37227110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University