View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6396_low_11 (Length: 240)

Name: NF6396_low_11
Description: NF6396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6396_low_11
NF6396_low_11
[»] chr3 (1 HSPs)
chr3 (1-159)||(37227110-37227268)


Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 37227268 - 37227110
Alignment:
1 cggagttttaagatcccctgaatccgaacgagcaagactccggtaatgcattgaaaatgcagtcgagtccatcgtaatgtcgtcggagacaccggaatct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37227268 cggagttttaagatcccctgaatccgaacgagcaagactccggtaatgcattgaaaatgcagtcgagtccatcgtaatgtcgtcggagacaccggaatct 37227169  T
101 gataaacgttccggtttaatgaaatccgtcgatacaggaccacgaaattcgtcatctgc 159  Q
    ||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||    
37227168 gatagccgttccggtttaatgaaatccgtcgatacaggaccacgaaattcgtcatctgc 37227110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University