View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6396_low_5 (Length: 384)
Name: NF6396_low_5
Description: NF6396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6396_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 19 - 374
Target Start/End: Complemental strand, 3338522 - 3338164
Alignment:
| Q |
19 |
atttgtcaccctaattgagaaatgctttgaggataagacttggatttgaagtaagcacgcgtctaagaatctgacaaactcacacacatataatgaaatg |
118 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3338522 |
atttgtcaccctaattgagaaatgatttgaggataagacttggatttgaagtaagcacgcgtctaagaatctgacaaactcacacacagataatgaaatg |
3338423 |
T |
|
| Q |
119 |
aagaggaggaggg-ttgtgggatccaccatgagtgcattggatggagcatannnnnnnnnnnn--gccgacaaagggcatctttggatgcatgggtttta |
215 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3338422 |
aagaggaggaggggttgtggggtccaccatgagtgcattggatggagcataagagagagagagaggccgacaaagggcatctttggatgcatgggtttta |
3338323 |
T |
|
| Q |
216 |
gtatttgcgcacgcacgggagttgttattctcaatatatatcaatgacttgtgattaatatcatattattatcactaattaattttaggtaggtttcaga |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3338322 |
gtatttgcgcacgcacgggagttgttattctcaatatatatcaatgacttgtgattaatatcatattattatcactaattaattttaggtaggtttcaga |
3338223 |
T |
|
| Q |
316 |
gatttcagagtaattcagctaactcttcggtgctttccactgtctttttgtgatctctg |
374 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3338222 |
gatttcagagtaattcagctaactcttcggtgctttccactgtctttttgtgatctctg |
3338164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University