View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6398_high_13 (Length: 212)
Name: NF6398_high_13
Description: NF6398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6398_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 3e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 20 - 134
Target Start/End: Complemental strand, 7759377 - 7759263
Alignment:
| Q |
20 |
gtatgacgaggacgagcgagatttagatcaacagcatcgagaatcattacatgatcacttcctacatttatagaacttcttatatatcgtggctgctcca |
119 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7759377 |
gtatgatgaggacgagcgagatttagatcaacagcatcgagaatcattacatgatcacttcctacatttatagaacttcttatatatcgtggctgctcca |
7759278 |
T |
 |
| Q |
120 |
taactccacttagaa |
134 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
7759277 |
taactccacttagaa |
7759263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 20 - 111
Target Start/End: Complemental strand, 7819562 - 7819471
Alignment:
| Q |
20 |
gtatgacgaggacgagcgagatttagatcaacagcatcgagaatcattacatgatcacttcctacatttatagaacttcttatatatcgtgg |
111 |
Q |
| |
|
||||||||| | ||| ||||| ||||| || |||||| ||||||||||| | |||||| ||||| || |||||||||||||||| ||||| |
|
|
| T |
7819562 |
gtatgacgactatgagtgagatatagattaatagcatcaagaatcattacttagtcactttctacagttttagaacttcttatatagcgtgg |
7819471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University