View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6398_low_12 (Length: 218)
Name: NF6398_low_12
Description: NF6398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6398_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 95 - 203
Target Start/End: Original strand, 25272561 - 25272669
Alignment:
| Q |
95 |
caggtaaaatttaatctctttgacatagtttagtgagtggttggtaattgtttttcacannnnnnncgttacagtaatgagaatcaatttatgtgaatta |
194 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25272561 |
caggtaaaatttcatctctttgacatagtttagtgagtggttggtaattgtttttcacatgtttttcgttacagtaatgagaatcaatttatgtgaatta |
25272660 |
T |
|
| Q |
195 |
tgaatattt |
203 |
Q |
| |
|
||||||||| |
|
|
| T |
25272661 |
tgaatattt |
25272669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University