View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6399_high_13 (Length: 397)
Name: NF6399_high_13
Description: NF6399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6399_high_13 |
 |  |
|
| [»] scaffold0598 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0598 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: scaffold0598
Description:
Target: scaffold0598; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 16 - 346
Target Start/End: Original strand, 5437 - 5767
Alignment:
| Q |
16 |
catggtggtgttatgagtagcactcaaagcatttaattaatacgatcaaacctttaacagcttttgtcttcaaatccatggaccatccactttgagttgg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5437 |
catggtggtgttatgagtagcactcaaagcatttaattaatacgatcaaacctttaacagcttttgtcttccaatccatggaccatccactttgagttgg |
5536 |
T |
 |
| Q |
116 |
cgtcacatgaaagtgtgctttctaatgaagattgacgaataatttgctttgggtggcaaaatatattgaagactgaacctggtggccgatggtaccaaag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5537 |
cgtcacatgaaagtgtgctttctaatgaagattgacgaataatttgctttgggtggcaaaatatattgaagactgaacctggtggccgatggcaccaaag |
5636 |
T |
 |
| Q |
216 |
gcataatgagttgatatgggccattgggttactctacagaaacctaaataagcgaccaatcatttttataagagcttatttgtccccttatttggttacg |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5637 |
gcataatgagttgatatgggccattgggttactctacagaaacctaaataagcgaccaatcatttttataagagcttatttgtccccttatttggttacg |
5736 |
T |
 |
| Q |
316 |
agaattcaaaagcaagtatcttctttacata |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
5737 |
agaattcaaaagcaagtatcttctttacata |
5767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University