View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6399_high_32 (Length: 201)
Name: NF6399_high_32
Description: NF6399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6399_high_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 82; Significance: 6e-39; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 60 - 184
Target Start/End: Original strand, 25226443 - 25226568
Alignment:
| Q |
60 |
atcagtgcgctgaatgtgctgccaggattgcttttgtccgcttaaaattgtgtagcaattaattgtttgctttgtagtaagaccatctgcaagctgaata |
159 |
Q |
| |
|
||||||| |||||||||||||| |||||||||| |||| |||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25226443 |
atcagtgtgctgaatgtgctgctaggattgcttctgtcagcttgaaattgtgtagcaattaattgttttctttgtagtaagaccatctgcaagctgaatg |
25226542 |
T |
 |
| Q |
160 |
cattctctc-ttgttttacatatatt |
184 |
Q |
| |
|
|| ||||| |||||||||||||||| |
|
|
| T |
25226543 |
cacgctctctttgttttacatatatt |
25226568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 132 - 184
Target Start/End: Complemental strand, 43721810 - 43721758
Alignment:
| Q |
132 |
tgtagtaagaccatctgcaagctgaatacattctctcttgttttacatatatt |
184 |
Q |
| |
|
||||||| ||||||||||||||||||| ||| ||||||||||||| ||||||| |
|
|
| T |
43721810 |
tgtagtacgaccatctgcaagctgaatccatactctcttgttttagatatatt |
43721758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 59 - 158
Target Start/End: Original strand, 38115891 - 38115990
Alignment:
| Q |
59 |
tatcagtgcgctgaatgtgctgccaggattgcttttgtccgcttaaaattgtgtagcaattaattgtttgctttgtagtaagaccatctgcaagctgaat |
158 |
Q |
| |
|
||||||| |||||||||||| | || ||| || |||| | || ||| |||||||||||||||||||| || ||||||| ||||||||| ||||||||| |
|
|
| T |
38115891 |
tatcagtctgctgaatgtgctccttgggttgattctgtcggtttgaaaatgtgtagcaattaattgttttctctgtagtatgaccatctgtaagctgaat |
38115990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University