View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6399_low_24 (Length: 251)
Name: NF6399_low_24
Description: NF6399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6399_low_24 |
 | |
|
| [»] scaffold0598 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0598 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: scaffold0598
Description:
Target: scaffold0598; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 14 - 251
Target Start/End: Complemental strand, 6131 - 5897
Alignment:
| Q |
14 |
atattggttttagatattgaattttgcttctctttaagaactcatgttcgattcttgttagatagattaatttaacttctttnnnnnnnnnnnnnnnnnt |
113 |
Q |
| |
|
|||||||||||| ||||| |||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
6131 |
atattggttttaaatattaaattttacttctctttaagagctcatgttcgattcttgttagatagattaatttaacttctttaaaaaaaataaaaa---t |
6035 |
T |
|
| Q |
114 |
gcatacaagtccctaaagacccgcagggagagccccgcacataagtccctatgcctttaatgtactttgtcctaaagaccgataaatgatggggatcact |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6034 |
gcatacaagtccctaaagacccgcagggagagccccgcacatatgtccctatgcctttaatgtactttgtcctaaagaccgataaatgatggggatcact |
5935 |
T |
|
| Q |
214 |
atggtgtagcttttctttgaagaaaggagtttatagca |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5934 |
atggtgtagcttttctttgaagaaaggagtttatagca |
5897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University