View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6399_low_26 (Length: 246)
Name: NF6399_low_26
Description: NF6399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6399_low_26 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 15 - 246
Target Start/End: Original strand, 2531894 - 2532125
Alignment:
| Q |
15 |
ctgtgagtcaaaacaattggggatagttttccttcttttatgattatttgttttggtacatatgcatgtgacaagggaccagcaacaacaaataatttcg |
114 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2531894 |
ctgtgagtcaaaacaattggtgatagttttccttcttttatgattatttgttttggtacatatgcatgtgacaagggaccagcaacaacaaataatttcg |
2531993 |
T |
 |
| Q |
115 |
aaggacaggtatgtccttaaattcgtcactcaaaaattaatattaatatatattacttattaaatcctaccatttcaatgttgtttgtcaatagtactat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2531994 |
aaggacaggtatgtccttaaattcgtcactcaaaaattaatattaatatatactacttattaaatcctaccatttcaatgttgtttgtcaataatactat |
2532093 |
T |
 |
| Q |
215 |
tatagtatctcttgagatgatatggaaatcct |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2532094 |
tatagtatctcttgagatgatatggaaatcct |
2532125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University