View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6399_low_34 (Length: 224)

Name: NF6399_low_34
Description: NF6399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6399_low_34
NF6399_low_34
[»] chr8 (1 HSPs)
chr8 (14-206)||(40515941-40516130)


Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 14 - 206
Target Start/End: Original strand, 40515941 - 40516130
Alignment:
14 cacagatagccgaagttcaaccttggcaaattttttgcactttgaaaatggtctaaaagccccattcggattttcgaatttaaaaattggaggcattttc 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40515941 cacagatagccgaagttcaaccttggcaaattttttgcactttgaaaatggtctaaaagccccattcggattttcgaatttaaaaattggaggcattttc 40516040  T
114 gaaatttgagatagtgtgcg-gaagcatggtgggtgaaaaaagaaattttctaaaaatattggcaaacaactattttggtttatgagtgtgcaa 206  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||    |||||||||||||||||||||||||||    
40516041 gaaatttgagatagtgtgcgagaagcatggtgggtgaaaaaagaaattctctaaaaatattgg----caactattttggtttatgagtgtgcaa 40516130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University