View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6399_low_36 (Length: 201)

Name: NF6399_low_36
Description: NF6399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6399_low_36
NF6399_low_36
[»] chr2 (1 HSPs)
chr2 (60-184)||(25226443-25226568)
[»] chr7 (1 HSPs)
chr7 (132-184)||(43721758-43721810)
[»] chr5 (1 HSPs)
chr5 (59-158)||(38115891-38115990)


Alignment Details
Target: chr2 (Bit Score: 82; Significance: 6e-39; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 60 - 184
Target Start/End: Original strand, 25226443 - 25226568
Alignment:
60 atcagtgcgctgaatgtgctgccaggattgcttttgtccgcttaaaattgtgtagcaattaattgtttgctttgtagtaagaccatctgcaagctgaata 159  Q
    ||||||| |||||||||||||| |||||||||| |||| |||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||     
25226443 atcagtgtgctgaatgtgctgctaggattgcttctgtcagcttgaaattgtgtagcaattaattgttttctttgtagtaagaccatctgcaagctgaatg 25226542  T
160 cattctctc-ttgttttacatatatt 184  Q
    ||  ||||| ||||||||||||||||    
25226543 cacgctctctttgttttacatatatt 25226568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 37; Significance: 0.000000000004; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 132 - 184
Target Start/End: Complemental strand, 43721810 - 43721758
Alignment:
132 tgtagtaagaccatctgcaagctgaatacattctctcttgttttacatatatt 184  Q
    ||||||| ||||||||||||||||||| ||| ||||||||||||| |||||||    
43721810 tgtagtacgaccatctgcaagctgaatccatactctcttgttttagatatatt 43721758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 59 - 158
Target Start/End: Original strand, 38115891 - 38115990
Alignment:
59 tatcagtgcgctgaatgtgctgccaggattgcttttgtccgcttaaaattgtgtagcaattaattgtttgctttgtagtaagaccatctgcaagctgaat 158  Q
    |||||||  |||||||||||| |  || ||| || |||| | || ||| |||||||||||||||||||| || ||||||| ||||||||| |||||||||    
38115891 tatcagtctgctgaatgtgctccttgggttgattctgtcggtttgaaaatgtgtagcaattaattgttttctctgtagtatgaccatctgtaagctgaat 38115990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University