View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6400_high_10 (Length: 269)
Name: NF6400_high_10
Description: NF6400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6400_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 13 - 229
Target Start/End: Original strand, 27725416 - 27725629
Alignment:
| Q |
13 |
atatgaaggtgataaataacatgttctgtgtgactgtaatttgagcagctatgcttaggaaaaccaacttgttcggttccaatggtcaaagcaactttca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27725416 |
atatgaaggtgataaataacatgttctgtgtgactgtaatttgagcagctatgcttaggaaaaccaacttgttcggttccaatggtcaaagcaactttca |
27725515 |
T |
 |
| Q |
113 |
ccggtggcaatgatggttgtccagatattgtgaagacgcttgcaatccaagtgaagtgtggatgagttgagctagtagtgatttggttggtgaagttgat |
212 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27725516 |
ccggtggcaatgatggttgtccagatgttgtgaagacgcttgcaatccaagtgaagtgtggatgagttgagc---tagtgatttggttggtgaagttgat |
27725612 |
T |
 |
| Q |
213 |
ggagtccatgagctcaa |
229 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
27725613 |
ggagtccatgagctcaa |
27725629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University