View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6400_high_12 (Length: 250)
Name: NF6400_high_12
Description: NF6400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6400_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 825916 - 826155
Alignment:
| Q |
1 |
catacattgtcacatctctgttcccttcattttccctcacatctgttgcgactgctgtgatctttactagttcataattacgaccgatgtctttaactag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
825916 |
catacattgtcacatctctgttcccttcattttccctcacatctgttgcgactgctgtgatctttactagttcataattacgaccgatgtctttaactag |
826015 |
T |
 |
| Q |
101 |
ctcttcatgtttgaattcacttcactcaaagtgttatgttccattgaggcttgaacttgaaatttgaaacattattattacttttaacaatgaaggttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
826016 |
ctcttcatgtttgaattcacttcactcaaagttttatgttccattgaggcttgaacttgaaatttgaaacattattattacttttaacaatgaaggttta |
826115 |
T |
 |
| Q |
201 |
tcctggaacacgagctggtggggttgtagcagagatgatg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
826116 |
tcctggaacacgagctggtggggttgtagcagatatgatg |
826155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University