View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6400_high_14 (Length: 248)
Name: NF6400_high_14
Description: NF6400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6400_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 7 - 195
Target Start/End: Original strand, 42634828 - 42635016
Alignment:
| Q |
7 |
tttctgtgttgtatagagatttctgtgtgtaataatttcagtacaaatagtgtgttgctcaaaacaataaatctataaacttgaaaaatgaatgtttctt |
106 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42634828 |
tttctgcgttgtatagagatttctgtgtgtaataatttcagtacaaatagtgtgttgctcaaaacaataaatctataaacttgaaaaatgaatgtttctt |
42634927 |
T |
 |
| Q |
107 |
ctttccaaaaaataagtaatagattctttctcttttctggacggtggaaatgaggccaataacatttgcagaacagtaatggcccaggc |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42634928 |
ctttccaaaaaataagtaatagattctttctcttctctggacggtggaaatgaggccaataacatttgcagaacagtaatggcctaggc |
42635016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 130 - 162
Target Start/End: Complemental strand, 42635447 - 42635415
Alignment:
| Q |
130 |
ttctttctcttttctggacggtggaaatgaggc |
162 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
42635447 |
ttctttctcttctctggacggtggaaatgaggc |
42635415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University