View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6400_high_17 (Length: 240)
Name: NF6400_high_17
Description: NF6400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6400_high_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 16012662 - 16012428
Alignment:
| Q |
1 |
tgaaattacaaagttttggcttcccttgtcgactatacttaactaactgggttcctctttttaatgtaatgaatgccttcacacaaaaacataaaattaa |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16012662 |
tgaaattacaaagtttcggcttcccttgtcgactatacttaactaactgggttcctctttttaatgtaatgaatgccttcacacaaaaacataaaattaa |
16012563 |
T |
|
| Q |
101 |
gtaagtggagcacctaagaaacataatatttagtatatcatatcaagtta-taatcattttgaaattcatattgcagatatgtaaactactatataaatt |
199 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16012562 |
gtaagtggagcacctaagcaacataatatttagtatatcatatcaagttattaatcattttgaaattcatattgcagatatgtaaactactatataaatt |
16012463 |
T |
|
| Q |
200 |
caatggctacataatccctagaatgatgatgtcca |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
16012462 |
caatggctacataatccctagaatgatgatgtcca |
16012428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University