View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6400_high_5 (Length: 327)
Name: NF6400_high_5
Description: NF6400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6400_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 1 - 152
Target Start/End: Complemental strand, 23149738 - 23149587
Alignment:
| Q |
1 |
tgcacgggtataagcattcatttctcatggaaatactcttacaacattaccaattcaaaagtagagaaaatagacatataagctctacaaccaaactcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23149738 |
tgcacgggtataagcattcatttctcatggaaatactcttacaacattaccaattcaaaagtagagaaaatagatatataagctctacaaccaaactcta |
23149639 |
T |
|
| Q |
101 |
aagtgatcttgagctaaaactaagatgactgggtactacgatccaccaataa |
152 |
Q |
| |
|
|| |||| ||||||| ||||| |||||||||||||||| || ||||| |||| |
|
|
| T |
23149638 |
aattgattttgagctgaaacttagatgactgggtactaggacccacctataa |
23149587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University