View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6400_low_10 (Length: 288)

Name: NF6400_low_10
Description: NF6400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6400_low_10
NF6400_low_10
[»] chr3 (2 HSPs)
chr3 (69-145)||(42820941-42821021)
chr3 (9-71)||(42820841-42820903)


Alignment Details
Target: chr3 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 69 - 145
Target Start/End: Original strand, 42820941 - 42821021
Alignment:
69 aaaaaacagaacatagaattcagcttttacattataa----gcagtcatattctcaatatggtgacactttttactttcaa 145  Q
    ||||||||||||||| |||||||||||||||||||||    ||||||||||||||||||||||||||||||||||||||||    
42820941 aaaaaacagaacatataattcagcttttacattataattaagcagtcatattctcaatatggtgacactttttactttcaa 42821021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 9 - 71
Target Start/End: Original strand, 42820841 - 42820903
Alignment:
9 catcatcaaataaaagaggctcaatcctgtaggattacttcatgtacaattttttaaaataaa 71  Q
    |||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
42820841 catcgtcaaataaaagaggctctatcctgtaggattacttcatgtacaattttttaaaataaa 42820903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University