View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6400_low_11 (Length: 274)
Name: NF6400_low_11
Description: NF6400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6400_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 17 - 264
Target Start/End: Complemental strand, 16460054 - 16459802
Alignment:
| Q |
17 |
actaatcatagaatgataatgattttccattttaatgtaccagttattaaag-aaatcgattgttgttattatgtttatgaagtttgaattttccagatt |
115 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16460054 |
actaatcgtagaatgataatgattttccattttaatgtaccagtcattaaagtaaatcgattgttgttattatgtttatgaagtttgaattttccagatt |
16459955 |
T |
 |
| Q |
116 |
attattaatatcctacttcactttaatttgtcgatgtgttactcttctttggcatgatt----tatatggtgtttgctttatttggaacttttagtttgg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16459954 |
attattaatatcctacttcactttaatttgtcgatgtgttactcttctttggcatgatttacatatatggtgtttgctttatttggaacttttagtttgg |
16459855 |
T |
 |
| Q |
212 |
tgcaattaatcttccatctaggccaaaatagaaaattaacttaggcacctatg |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
16459854 |
tgcaattaatcttccatctaggccaaaatagaaaattaacttatgcacctatg |
16459802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University